si:dkey-24l11.3

Ensembl ID:
ENSDARG00000068140
ZFIN ID:
ZDB-GENE-050419-162
Description:
hypothetical protein LOC100034462 [Source:RefSeq peptide;Acc:NP_001076531]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36666 Nonsense Mutation detected in F1 DNA During 2018
sa29046 Nonsense Mutation detected in F1 DNA During 2018
sa12363 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098350 Nonsense 10 696 1 12
ENSDART00000147735 Nonsense 10 240 1 2

The following transcripts of ENSDARG00000068140 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 26838969)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26912224
GRCz11 18 26894602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAGGGTGTTTGTCGATCTAATGGAGTCAGAAAGTGCGGGTGTGGCG[C/T]AGGTTAGTGGCTAACCTCAGTTAAACAACATCCACCAGTGGTTTTGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098350 Nonsense 62 696 2 12
ENSDART00000147735 Nonsense 62 240 2 2

The following transcripts of ENSDARG00000068140 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 26836084)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26909339
GRCz11 18 26891717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGCTGAACGGGTGCAGCAATTGTGTCGCTTCTACTCTCAGGGCAGG[C/T]GATGCTATTATGGAAAAAGGTGCCACTTTCTTCATCAGAGAGCTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098350 Essential Splice Site 636 696 None 12
ENSDART00000147735   None 240 None 2

The following transcripts of ENSDARG00000068140 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 26814478)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26887733
GRCz11 18 26870111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATGGAGCTGGCCACCAGAATGATYTGCGGTTACTGTGCCAAAGAGCAGG[T/G]CAGCGACAGAAACTCCCTCAGACCGACTGAAGCAGGATTAYATTCACCYC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link