zgc:158569

Ensembl ID:
ENSDARG00000068103
ZFIN ID:
ZDB-GENE-070209-143
Description:
hypothetical protein LOC325276 [Source:RefSeq peptide;Acc:NP_001076465]
Human Orthologue:
CCDC19
Human Description:
coiled-coil domain containing 19 [Source:HGNC Symbol;Acc:17229]
Mouse Orthologue:
Ccdc19
Mouse Description:
coiled-coil domain containing 19 Gene [Source:MGI Symbol;Acc:MGI:1919120]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18014 Nonsense Available for shipment Available now
sa43142 Nonsense Mutation detected in F1 DNA During 2018
sa23333 Nonsense Available for shipment Available now
sa23334 Nonsense Available for shipment Available now
sa6528 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Nonsense 97 497 5 12
ENSDART00000127379 Nonsense 143 345 5 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33525682)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35206957
GRCz11 18 35181830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTAAATCTAGTTMTTTTGATGTTGTAAGGWTGCTGYAGAGCAGAGG[A/T]AAGCACAAATGCGCCAGGCTGACYTRTCTCGTCAGAAGAACCAGAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Nonsense 172 497 6 12
ENSDART00000127379 Nonsense 218 345 6 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33525985)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35207260
GRCz11 18 35182133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCCGGGATGTACAGATTCAGGAGAGGAAACTAAACTCTGCAGAGTG[G/A]CTGGCCGAGGAGAAGAGACTGGACGCCATGATGGAGGTGGAGCGCCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Nonsense 195 497 6 12
ENSDART00000127379 Nonsense 241 345 6 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33526052)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35207327
GRCz11 18 35182200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGACGCCATGATGGAGGTGGAGCGCCGCCAGGCTTTAGAAGCTCAG[G/T]AACAAATTGAACAGCTTCGCAAACAGCAGAGGATTCAGTAAGCATGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Nonsense 236 497 7 12
ENSDART00000127379 Nonsense 282 345 7 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33526259)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35207534
GRCz11 18 35182407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGGAGGAGAAACTGCTACAGGATGAGATGAAGGAACAGGAGGGTCAG[C/T]AGTTGCTGGAAAACATGGAGAGGATGCAGATGGAGGAGCTCAAGGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Essential Splice Site 250 497 7 12
ENSDART00000127379 Essential Splice Site 296 345 7 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33526304)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35207579
GRCz11 18 35182452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGCAGTTGCTGGARAACATGGAGAGGATGCAGATGGAGGAGCTCAAG[G/T]TTCACAACGGAATMTCTMAATCACTTCAAATYTYGAGTAGCTGTTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098292 Nonsense 467 497 11 12
ENSDART00000127379   None 345 None 8

The following transcripts of ENSDARG00000068103 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33530758)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35211942
GRCz11 18 35186805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGAACGGCTGGAGGAGGAGGCACGCAATCGCAGAGCCCGACTGGAT[G/T]AGATTAAAGAAAAGAAGCTCARGGAACTCAAGTATGTTCTCAACGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link