sirt1

Ensembl ID:
ENSDARG00000068064
ZFIN ID:
ZDB-GENE-070801-2
Human Orthologue:
SIRT1
Human Description:
sirtuin 1 [Source:HGNC Symbol;Acc:14929]
Mouse Orthologue:
Sirt1
Mouse Description:
sirtuin 1 (silent mating type information regulation 2, homolog) 1 (S. cerevisiae) Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22388 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098209 Nonsense 628 710 8 9
Genomic Location (Zv9):
Chromosome 13 (position 51328200)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50039297
GRCz11 13 50352540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCAGACGCTGCTGGAGGAGCCGAATCTGTCAGAGTCCAATCAGCAAA[C/T]GACTCGGAGGTAAAACAATACATTTTATTTTAAACCACACATTTCTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link