si:dkey-7o6.7

Ensembl ID:
ENSDARG00000068050
ZFIN ID:
ZDB-GENE-081104-437
Description:
Novel protein similar to vertebrate ATP/GTP binding protein-like 4 (AGBL4) [Source:UniProtKB/TrEMBL;
Human Orthologue:
AGBL4
Human Description:
ATP/GTP binding protein-like 4 [Source:HGNC Symbol;Acc:25892]
Mouse Orthologue:
Agbl4
Mouse Description:
ATP/GTP binding protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:1918244]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41158 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12099 Nonsense Available for shipment Available now
sa21233 Nonsense Available for shipment Available now
sa34357 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063707 Essential Splice Site 127 486 4 13
ENSDART00000132908   None 226 None 6
Genomic Location (Zv9):
Chromosome 8 (position 16273735)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15718623
GRCz11 8 15754396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGATGGGATGTCCCCCGTGGTGAAGTCGACCAGCCGGCCTAAATGG[T/A]ATTCATACCCTCTGCAAATATCACATCTCCACCTACACACTGCGCTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063707 Nonsense 178 486 5 13
ENSDART00000132908   None 226 None 6
Genomic Location (Zv9):
Chromosome 8 (position 16150549)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15595893
GRCz11 8 15633598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCAGTTTGCATACTGCTACCCCTACACCTATTCGCGTCTGCAACATTA[C/A]CTGGCCAGCCTGGAGCGCAGAAACCTCGATTACCTGCAGCGAGAACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063707 Nonsense 219 486 7 13
ENSDART00000132908   None 226 None 6
Genomic Location (Zv9):
Chromosome 8 (position 15928369)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15373713
GRCz11 8 15411418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTTCTGCATTTATGTGTGTGTGTGTTTCAGCCCATCTGAACCAAGAG[C/T]GAGAAAAGCGGGTGGTATTTCTCACAGCCCGCGTTCACCCCGGAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063707 Essential Splice Site 243 486 None 13
ENSDART00000132908 Essential Splice Site 24 226 None 6
Genomic Location (Zv9):
Chromosome 8 (position 15928295)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15373639
GRCz11 8 15411344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCCGCGTTCACCCCGGAGAATCACCTGCTTCCTTCATCTGTCAGGG[T/C]AAGACCTTGTCTCGTCTCGACACACAAACACAAGGCAGATGATGTCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link