
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-224b1.4
- Ensembl ID:
- ENSDARG00000068021
- ZFIN ID:
- ZDB-GENE-070912-214
- Description:
- Novel protein with Methyltransferase domains [Source:UniProtKB/TrEMBL;Acc:B0V121]
- Human Orthologue:
- METTL13
- Human Description:
- methyltransferase like 13 [Source:HGNC Symbol;Acc:24248]
- Mouse Orthologue:
- Mettl13
- Mouse Description:
- methyltransferase like 13 Gene [Source:MGI Symbol;Acc:MGI:1918699]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19861 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19861
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098123 | Nonsense | 66 | 243 | 3 | 4 |
ENSDART00000147292 | Nonsense | 66 | 167 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 2 (position 44898838)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 44984339 GRCz11 2 44837337 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTCTCTCTGTCAGGTTGTGGTAACAGTGCGCTGAGCTATGATATGTGC[C/T]AGGCCGGCTACAGCTCCATCACTAATGTGGATTACTCTAGTGTCTGTGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: