Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
myhz1.3
- Ensembl ID:
- ENSDARG00000067997
- ZFIN ID:
- ZDB-GENE-070705-74
- Description:
- Novel myosin family protein [Source:UniProtKB/TrEMBL;Acc:B8A569]
- Human Orthologues:
- MYH6, MYH7
- Human Descriptions:
- myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
- myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
- Mouse Orthologues:
- Myh6, Myh7
- Mouse Descriptions:
- myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
- myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20463 | Nonsense | Available for shipment | Available now |
| sa10927 | Essential Splice Site | Available for shipment | Available now |
| sa40477 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa6057 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20463
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122889 | Nonsense | 409 | 1937 | 13 | 41 |
| ENSDART00000127125 | None | 423 | None | 9 | |
| ENSDART00000130531 | Nonsense | 409 | 790 | 13 | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33909193)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31671425 GRCz11 5 32271578 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGTTTGAACTCTGCTGATATGCTTAAGGCTTTGTGTTACCCCAGAGTC[A/T]AGGTCGGAAATGAGTTTGTGACCAAAGGACAGACTGTGCCACAGGTATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10927
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122889 | Essential Splice Site | 723 | 1937 | 19 | 41 |
| ENSDART00000127125 | None | 423 | None | 9 | |
| ENSDART00000130531 | Essential Splice Site | 723 | 790 | 19 | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33907635)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31669867 GRCz11 5 32270020 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGGTGACTTCAAGCAGAG[G/T]TAAATGGGACTTTATGAAAATGTAATTTACTGTAAGAGTCAATTTAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40477
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122889 | Nonsense | 1744 | 1937 | 36 | 41 |
| ENSDART00000127125 | Nonsense | 230 | 423 | 4 | 9 |
| ENSDART00000130531 | None | 790 | None | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33901240)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31663472 GRCz11 5 32263625 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACCAAGAAGAAGCTTGAGGCTGACCTTGTTCAGATCCAGAGTGAAGTT[G/T]AAGACACTGTACAGGAAGCCAGAAATGCAGAGGAGAAGGCCAAGAAGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6057
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122889 | Nonsense | 1876 | 1937 | 39 | 41 |
| ENSDART00000127125 | Nonsense | 362 | 423 | 7 | 9 |
| ENSDART00000130531 | None | 790 | None | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33900549)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31662781 GRCz11 5 32262934 - KASP Assay ID:
- 554-3885.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAAGAAGAATGTCAACAGGCTGCAGGATCTGGTTGATAAGCTTCAGCTG[A/T]AGGTCAAGGCTTMCAAGAGACAGTCTGAAGAAGCTGTGAGTTCCTCATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Electrocardiographic traits: Several common variants modulate heart rate, PR interval and QRS duration. (View Study)
- Resting heart rate: Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants. (View Study)
- Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
- Atrial septal defect 3
- Cardiomyopathy, dilated, 1EE
- Cardiomyopathy, familial hypertrophic, 14
- Sick sinus syndrome 3
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
