gtf3c5

Ensembl ID:
ENSDARG00000067979
ZFIN ID:
ZDB-GENE-060810-66
Human Orthologue:
GTF3C5
Human Description:
general transcription factor IIIC, polypeptide 5, 63kDa [Source:HGNC Symbol;Acc:4668]
Mouse Orthologue:
Gtf3c5
Mouse Description:
general transcription factor IIIC, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1917489]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44960 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091835 Nonsense 149 529 3 11
Genomic Location (Zv9):
Chromosome 21 (position 9797098)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11280461
GRCz11 21 11373089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATAGATTTTTTCCATTTCTCACTTTAGGAATGGCTGACTTTCAGTA[T/A]CTGGCATCTCACAACAACCCAGAAGGCAACCAGGTCTCCCTGTACGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link