
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ar
- Ensembl ID:
- ENSDARG00000067976
- ZFIN ID:
- ZDB-GENE-060131-1
- Description:
- androgen receptor [Source:RefSeq peptide;Acc:NP_001076592]
- Human Orthologue:
- AR
- Human Description:
- androgen receptor [Source:HGNC Symbol;Acc:644]
- Mouse Orthologue:
- Ar
- Mouse Description:
- androgen receptor Gene [Source:MGI Symbol;Acc:MGI:88064]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20471 | Essential Splice Site, Missense | Available for shipment | Available now |
sa40491 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20472 | Nonsense | Available for shipment | Available now |
sa44611 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20471
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > G
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098022 | Missense | 177 | 868 | 1 | 8 |
ENSDART00000125329 | Essential Splice Site | 170 | 860 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37180130)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 34962079 GRCz11 5 35562232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGTGCGTGCACCACCGCCACCATCACCTCCAGCAGCAGCAGCAGCAGCA[C/G]CACTACCAGCTGCACCATATCAGAGACAGCGCGAGAGTTGTGCAAAGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40491
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098022 | Nonsense | 230 | 868 | 1 | 8 |
ENSDART00000125329 | Nonsense | 222 | 860 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37180290)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 34962239 GRCz11 5 35562392 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGCACCGCCGCCACCGCCCCTGACCACTGAAAGTAGTGAGGAGATCTA[T/A]TTGTACGGAATGCCTTTGCTCGACTGCTCAGTGAGCGAACGAGAGGCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20472
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098022 | Nonsense | 509 | 868 | 2 | 8 |
ENSDART00000125329 | Nonsense | 501 | 860 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37225825)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35007774 GRCz11 5 35607927 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGACGGAGGGAGGAGTGACATTTTCCCAATGGAGTTTTTCCTTCCTCCA[C/T]AAAGGACCTGCCTAATCTGCTCTGATGAAGCATCTGGGTGTCACTACGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44611
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098022 | Nonsense | 589 | 868 | 4 | 8 |
ENSDART00000125329 | Nonsense | 581 | 860 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37289113)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35071062 GRCz11 5 35671215 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTATATTGTTTTTGTTCTGTGCCACAGCCCGCAAGCTGAGGAAGATTGGA[C/T]AGATGAAAGGTCCGGATGAGGTCGGAGCAGTTCAGGGCCCGTCGGAGACT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Male-pattern baldness: Male-pattern baldness susceptibility locus at 20p11. (View Study)
- Male-pattern baldness: Six novel susceptibility Loci for early-onset androgenetic alopecia and their unexpected association with common diseases. (View Study)
- Male-pattern baldness: Susceptibility variants on chromosome 7p21.1 suggest HDAC9 as a new candidate gene for male-pattern baldness. (View Study)
- Metabolic traits: Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (View Study)
- Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: