sh3gl1a

Ensembl ID:
ENSDARG00000067958
ZFIN ID:
ZDB-GENE-030131-4524
Description:
SH3-domain GRB2-like 1a isoform 1 [Source:RefSeq peptide;Acc:NP_001099076]
Human Orthologue:
SH3GL1
Human Description:
SH3-domain GRB2-like 1 [Source:HGNC Symbol;Acc:10830]
Mouse Orthologue:
Sh3gl1
Mouse Description:
SH3-domain GRB2-like 1 Gene [Source:MGI Symbol;Acc:MGI:700010]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19889 Nonsense Available for shipment Available now
sa19890 Essential Splice Site Available for shipment Available now
sa45121 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097966 Nonsense 21 365 3 11
ENSDART00000129967 Nonsense 22 365 2 10
Genomic Location (Zv9):
Chromosome 2 (position 50049409)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49744941
GRCz11 2 49479171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGACTTTTATTTGTTTTTTTTATTCTAGTTGATGAGTGAGAAGGTT[G/T]GAGGAGCAGAAGGAACCAAACTGGACGAGGACTTCAAAGATCTGGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097966 Essential Splice Site 110 365 5 11
ENSDART00000129967 Essential Splice Site 111 365 4 10
Genomic Location (Zv9):
Chromosome 2 (position 50056364)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49751896
GRCz11 2 49486126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCATGCTGAAATACGGTCGAGACATGGGAGAAGACACCAACTTCGG[T/A]AAGAAGAACGAGTGCTCTTTCTCTAACACTTTAACAAACAGAAAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097966 Nonsense 277 365 9 11
ENSDART00000129967 Nonsense 278 365 8 10
Genomic Location (Zv9):
Chromosome 2 (position 50070324)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49765856
GRCz11 2 49500086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATTGATTACTCGGATCCAGAAGACTCCAACGGAGGCTGGAATCCAT[C/A]AGCAGCAGCACCACCCTCATACTCATCCACAGGTCAGATCAACCTGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link