zgc:63779

Ensembl ID:
ENSDARG00000067947
ZFIN ID:
ZDB-GENE-040426-1260
Description:
tRNA-dihydrouridine synthase 3-like [Source:RefSeq peptide;Acc:NP_956968]
Human Orthologue:
DUS3L
Human Description:
dihydrouridine synthase 3-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26920]
Mouse Orthologue:
Dus3l
Mouse Description:
dihydrouridine synthase 3-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147092]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17816 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097929 Nonsense 129 659 4 15
ENSDART00000123251 Nonsense 129 660 4 16
ENSDART00000147780   None 224 None 6
Genomic Location (Zv9):
Chromosome 19 (position 439022)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 428853
GRCz11 19 429060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAYGATGTGAGCGAGTATCTGTCCACGAAAGCTGCGGATCTGGGTGAT[C/T]AGTGTCACCTTTTCAAYACCTTRGGGAAGTGTCCGTATGGCCTGACCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link