si:dkey-27n6.1

Ensembl ID:
ENSDARG00000067858
ZFIN ID:
ZDB-GENE-041014-40
Description:
hypothetical protein LOC100034375 [Source:RefSeq peptide;Acc:NP_001137523]
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38278 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097774 Essential Splice Site 15 736 2 5
Genomic Location (Zv9):
Chromosome 1 (position 37559281)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 69527189
GRCz11 4 71553157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTGAAGTTTGTCCTGCAGTTTATTGCTCTGGTGTGTTTGTGTGTTC[A/C]GTGTGAGATCAGGATCAGGTGTGTCCAGCTCTGTGTCTCTGAAGAGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link