si:dkeyp-27c8.1

Ensembl ID:
ENSDARG00000067808
ZFIN ID:
ZDB-GENE-090313-381
Human Orthologues:
DUPD1, DUSP13
Human Descriptions:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
dual specificity phosphatase and pro isomerase domain containing 1 [Source:HGNC Symbol;Acc:23481]
Mouse Orthologues:
Dupd1, Dusp13
Mouse Descriptions:
dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]
dual specificity phosphatase and pro isomerase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086613 Nonsense 69 183 3 6
ENSDART00000133414 Nonsense 160 292 3 4
ENSDART00000136230   None 193 None 2
ENSDART00000141432   None 131 None 2
Genomic Location (Zv9):
Chromosome 23 (position 41047152)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40880006
GRCz11 23 40772910
KASP Assay ID:
2261-8190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTGGGAGTCACCCATATCCTAAATGCAGCAGCGCCGAAGATGGCCTG[G/A]TTGGGAAAACTAAGTAAGAGTGGAGTCAACGGAAAGGTCCTTACAGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link