zgc:158432

Ensembl ID:
ENSDARG00000067806
ZFIN ID:
ZDB-GENE-061201-57
Description:
hypothetical protein LOC555281 [Source:RefSeq peptide;Acc:NP_001073426]
Mouse Orthologue:
2010106E10Rik
Mouse Description:
RIKEN cDNA 2010106E10 gene Gene [Source:MGI Symbol;Acc:MGI:1914965]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20474 Nonsense Available for shipment Available now
sa9103 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097671 Nonsense 92 310 3 11
Genomic Location (Zv9):
Chromosome 5 (position 38148681)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35948365
GRCz11 5 36548518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGACCTTTGCCCTGGTGGCGTCTCTGCCTGGTCTAACTCTCGCCGTGT[T/A]GGTGGGGGTAATTGTTTACATGCTGATGGTGCAGTCAAACAACAGCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097671 Nonsense 98 310 3 11
Genomic Location (Zv9):
Chromosome 5 (position 38148662)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35948346
GRCz11 5 36548499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCTCTGCCTGGTCTMACTCTCGCCGTGTTGGTGGGGGTAATTGTTTA[C/A]ATGCTGATGGTGCAGTCAAACAAMAGCCWCACAAGGTGAGTNCACTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link