snx18a

Ensembl ID:
ENSDARG00000067713
ZFIN ID:
ZDB-GENE-070705-339
Description:
sorting nexin-18 [Source:RefSeq peptide;Acc:NP_001093476]
Human Orthologue:
SNX18
Human Description:
sorting nexin 18 [Source:HGNC Symbol;Acc:19245]
Mouse Orthologue:
Snx18
Mouse Description:
sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097525 Nonsense 416 567 1 2
Genomic Location (Zv9):
Chromosome 5 (position 41916182)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39690899
GRCz11 5 40291052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCTGGCTTCAAGAAAGAGTATCAGAAAGTGGGACAGTCTTTTAAGTA[T/A]CTGAGTCAAGCATTCGAGATGGACCAGCAGTCATACTCCATTGGTTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link