zgc:162304

Ensembl ID:
ENSDARG00000067711
ZFIN ID:
ZDB-GENE-070410-67
Description:
gamma-parvin [Source:RefSeq peptide;Acc:NP_001083007]
Human Orthologue:
PARVG
Human Description:
parvin, gamma [Source:HGNC Symbol;Acc:14654]
Mouse Orthologue:
Parvg
Mouse Description:
parvin, gamma Gene [Source:MGI Symbol;Acc:MGI:2158329]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44226 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097522 Nonsense 206 315 9 13
Genomic Location (Zv9):
Chromosome 25 (position 5414591)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4953564
GRCz11 25 5079992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGAATGTCCCATTGATGAGCTCTTCAAGCTGGAGGCGCACAAAATC[G/T]AGACCGTGAAGAAGGTCCCGATGCAGTTTTAAATGCTCTAAATGTAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link