snapc4

Ensembl ID:
ENSDARG00000067673
ZFIN ID:
ZDB-GENE-030131-5794
Description:
Novel protein similar to vertebrate small nuclear RNA activating complex, polypeptide 4, 190kDa (SNA
Human Orthologue:
SNAPC4
Human Description:
small nuclear RNA activating complex, polypeptide 4, 190kDa [Source:HGNC Symbol;Acc:11137]
Mouse Orthologue:
Snapc4
Mouse Description:
small nuclear RNA activating complex, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:2443935]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38504 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097473 Nonsense 170 393 5 11
ENSDART00000141424 Nonsense 152 615 6 16
Genomic Location (Zv9):
Chromosome 5 (position 52875281)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50542477
GRCz11 5 51189070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCGAGGAAAAAGAACAACTGAAAGCGCAAATAGAATTAATTGAGAAA[C/T]AAATAGCTGAAATAAGGTAACGTCATTTTAAGCACTTTCATCAGAGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link