zgc:153462

Ensembl ID:
ENSDARG00000067669
ZFIN ID:
ZDB-GENE-060825-359
Description:
hypothetical protein LOC751739 [Source:RefSeq peptide;Acc:NP_001038914]
Human Orthologue:
ZGLP1
Human Description:
zinc finger, GATA-like protein 1 [Source:HGNC Symbol;Acc:37245]
Mouse Orthologue:
Zglp1
Mouse Description:
zinc finger, GATA-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:3696042]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20602 Nonsense Available for shipment Available now
sa10013 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097468 Nonsense 320 351 5 5
Genomic Location (Zv9):
Chromosome 6 (position 91954)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 139013
GRCz11 6 157064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACGCAGTGTTCTTGTGCTCTGCAGGTATAAGAAGTACCGGGTGCGCTG[T/A]CAGCAGTGCTGGAACATCCCTAAGAAGGAAGCGAACACACACTCGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097468 Nonsense 337 351 5 5
Genomic Location (Zv9):
Chromosome 6 (position 92005)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 139064
GRCz11 6 157115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTGCTGGAACATCCCTAAGAAGGARGCGAACACACACTCGCAGTG[T/A]CTGAAGTGTGGAGACGYGYTGAAGATGAAGAGCGGCGGCTGGTAGGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link