zgc:154075

Ensembl ID:
ENSDARG00000067630
ZFIN ID:
ZDB-GENE-060929-910
Description:
hypothetical protein LOC556929 [Source:RefSeq peptide;Acc:NP_001073433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43960 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097381 Essential Splice Site 203 430 8 14
Genomic Location (Zv9):
Chromosome 23 (position 21094592)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20879595
GRCz11 23 20805938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTGCCATGATCTGGATCTGATTCATCACTGGGCTGGAGGACGAAGG[T/C]ACACTTAATCTACCATCCTTTTTTTGCACGTGTGCGGGAGCTGAGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link