si:ch211-154e10.2

Ensembl ID:
ENSDARG00000067613
ZFIN ID:
ZDB-GENE-081104-137
Human Orthologues:
DNAJC25, DNAJC25-GNG10
Human Descriptions:
DnaJ (Hsp40) homolog, subfamily C , member 25 [Source:HGNC Symbol;Acc:34187]
DNAJC25-GNG10 readthrough [Source:HGNC Symbol;Acc:37501]
Mouse Orthologue:
Dnajc25
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 25 Gene [Source:MGI Symbol;Acc:MGI:1919679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45238 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097359 Nonsense 178 354 3 4
Genomic Location (Zv9):
Chromosome 5 (position 72986679)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69184275
GRCz11 5 69956827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCAGCTACACAGAAGCCATCAACTACCTTATGACCGTTCCCAAATA[T/A]CGCATCCAGGCTACAGAACTGGCCAAGCAGCAGGGTCTGCTGAACAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link