zswim7

Ensembl ID:
ENSDARG00000067608
ZFIN ID:
ZDB-GENE-030131-4255
Description:
Zinc finger SWIM domain-containing protein 7 [Source:UniProtKB/Swiss-Prot;Acc:A4FVI0]
Human Orthologue:
ZSWIM7
Human Description:
zinc finger, SWIM-type containing 7 [Source:HGNC Symbol;Acc:26993]
Mouse Orthologue:
Zswim7
Mouse Description:
zinc finger, SWIM-type containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916997]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9071 Nonsense Mutation detected in F1 DNA During 2018
sa18824 Nonsense Mutation detected in F1 DNA During 2018
sa38520 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097351 Nonsense 72 140 4 5
ENSDART00000146879 Nonsense 72 140 5 6
ENSDART00000097351 Nonsense 72 140 4 5
ENSDART00000146879 Nonsense 72 140 5 6
Genomic Location (Zv9):
Chromosome 5 (position 65825527)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62080435
GRCz11 5 62765161
KASP Assay ID:
2259-6727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTMACATTTCATGTTTGTTTGTGTCTCCCTCTGTCAGGTATTAGGTGGAT[C/A]GGGTCGTCTGTACACGTGCTTCACGTCCTGTCACTACTGCCCGTGCCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097351 Nonsense 72 140 4 5
ENSDART00000146879 Nonsense 72 140 5 6
ENSDART00000097351 Nonsense 72 140 4 5
ENSDART00000146879 Nonsense 72 140 5 6
Genomic Location (Zv9):
Chromosome 5 (position 65825527)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62080435
GRCz11 5 62765161
KASP Assay ID:
2259-6727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACATTTCATGTTTGTTTGTGTCTCCCTCTGTCAGGTATTAGGTGGAT[C/A]GGGTCGTCTGTACACGTGCTTCACGTCCTGTCACTACTGCCCGTGCCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097351 Nonsense 122 140 5 5
ENSDART00000146879 Nonsense 122 140 6 6
Genomic Location (Zv9):
Chromosome 5 (position 65831314)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62086222
GRCz11 5 62770948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTTTGGCGGTCATCCTGAGTCAGGCCATGGGTTTGTGTCAGCAGGAG[C/T]AGGTCTCAGATCAGCAGATGACCCACATTCTCTCAAGGCAACCTGAGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link