si:dkeyp-117b8.3

Ensembl ID:
ENSDARG00000067605
ZFIN ID:
ZDB-GENE-060531-160
Description:
hypothetical protein LOC567306 [Source:RefSeq peptide;Acc:NP_001077030]
Human Orthologue:
NAPA
Human Description:
N-ethylmaleimide-sensitive factor attachment protein, alpha [Source:HGNC Symbol;Acc:7641]
Mouse Orthologue:
Napa
Mouse Description:
N-ethylmaleimide sensitive fusion protein attachment protein alpha Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10593 Essential Splice Site Available for shipment Available now
sa10045 Nonsense Available for shipment Available now
sa15113 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097338 Essential Splice Site 140 295 5 11
Genomic Location (Zv9):
Chromosome 5 (position 64997541)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61273031
GRCz11 5 61935768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATATCTGTTGCAGAAATCTATGAATCGGAGTTACTGGACATAGACAAA[G/A]TAAGTGGGAAATAATCTATTTATATAAGGGTTCGAATGTAKAGGCCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097338 Nonsense 177 295 7 11
Genomic Location (Zv9):
Chromosome 5 (position 64996351)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61271841
GRCz11 5 61934578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTAACAAGTGTCTTCTTAAGGTRGCGAACTATGCGGCTCAGTTGGAR[C/T]AGTACCAGAAAGCCATTGAAATTTTTGAGCAGGTYTGCATGACCCGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097338 Nonsense 198 295 8 11
Genomic Location (Zv9):
Chromosome 5 (position 64996207)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61271697
GRCz11 5 61934434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTTTCTCTGTTTCAGATTGGTACTTACTCTATGGACACTACACTGT[T/A]GAAGTATGGTGCCAAAGACCATTTCTTCAAAGCTGCACTGTGTCACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link