
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arfgap2
- Ensembl ID:
- ENSDARG00000067601
- ZFIN ID:
- ZDB-GENE-051120-177
- Description:
- ADP-ribosylation factor GTPase-activating protein 2 [Source:RefSeq peptide;Acc:NP_001032507]
- Human Orthologue:
- ARFGAP2
- Human Description:
- ADP-ribosylation factor GTPase activating protein 2 [Source:HGNC Symbol;Acc:13504]
- Mouse Orthologue:
- Arfgap2
- Mouse Description:
- ADP-ribosylation factor GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924288]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43166 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa29091 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13828 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43166
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097328 | Nonsense | 83 | 536 | 3 | 16 |
The following transcripts of ENSDARG00000067601 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 43269359)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 44859250 GRCz11 18 44852704 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAACTGGATTCCAACTGGAACTGGTTTCAGCTGAGATGCATGCAGGTT[G/T]GAGGAAACGCCAATGCGGTCAGTTCTCCTATAATATGCATAGAGTTGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29091
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097328 | Nonsense | 375 | 536 | 12 | 16 |
The following transcripts of ENSDARG00000067601 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 43286914)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 44876805 GRCz11 18 44870259 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTAGTAACTTGTAACTGTGTTTTCAGGTACAAGGACAACCCTTTCACAT[C/A]AGGAGACAGCTTTGGGTCACGGTGGGACAATGATGGCGGGTCGTCGTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13828
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097328 | Nonsense | 415 | 536 | 12 | 16 |
The following transcripts of ENSDARG00000067601 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 43287033)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 44876924 GRCz11 18 44870378 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGAGGAGCCTAAAGACAGCGAGGTCACCATCTCAAGCATCCAGCCAATC[G/T]GAGAAAGGTAACGTCCTCATCYGGCAGTCAGTGGGTTTGGYTTTGATTAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: