adam19b

Ensembl ID:
ENSDARG00000067545
ZFIN ID:
ZDB-GENE-070705-541
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW95]
Human Orthologue:
ADAM19
Human Description:
ADAM metallopeptidase domain 19 [Source:HGNC Symbol;Acc:197]
Mouse Orthologue:
Adam19
Mouse Description:
a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI Symbol;Acc:MGI:105377]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42343 Nonsense Mutation detected in F1 DNA During 2018
sa30976 Nonsense Mutation detected in F1 DNA During 2018
sa38979 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913   None 131 None 4
ENSDART00000143179   None 186 None 4
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913   None 131 None 4
ENSDART00000143179   None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6537906)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6265293
GRCz11 14 6572020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCGTGTCTGTGTTTTTCATAGGGAGCTGTTCTCCTCGGAATAT[C/T]AAGAAATATGGTACGATACAAATGGAAATCGGCAGTTTTCCAGACCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913   None 131 None 4
ENSDART00000143179   None 186 None 4
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913   None 131 None 4
ENSDART00000143179   None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6537906)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6265293
GRCz11 14 6572020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCGTGTCTGTGTTTTTCATAGGGAGCTGTTCTCCTCGGAATAT[C/T]AAGAAATATGGTACGATACAAATGGAAATCGGCAGTTTTCCAGACCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 731 870 19 21
ENSDART00000132913   None 131 None 4
ENSDART00000143179   None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6568593)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6295980
GRCz11 14 6602707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTTGACTGATGTTTTTGTCTTATCTTATGTGCAGGCAGCTTTTA[T/A]CTTGTGCTGGTTCTCCTCAGCTTGTCTTTTCTTCTGGCGTTGGCTGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link