
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fut9
- Ensembl ID:
- ENSDARG00000067524
- ZFIN ID:
- ZDB-GENE-030131-9925
- Description:
- fucosyltransferase 9 [Source:RefSeq peptide;Acc:NP_001007455]
- Human Orthologue:
- FUT9
- Human Description:
- fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
- Mouse Orthologue:
- Fut9
- Mouse Description:
- fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7116 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7116
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035965 | Nonsense | 280 | 370 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 3513559)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 3249599 GRCz11 8 3308348 - KASP Assay ID:
- 554-4446.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAAYGGTCCTCTTGCTGCAGGAACTGTTCCTGTGGTTTTGGGTCCTCCA[A/T]GAAAGAACTATGAAAACTTTGTTCCWGGAGAYGCCTTTATTCATGTGGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: