zgc:158482

Ensembl ID:
ENSDARG00000067520
ZFIN ID:
ZDB-GENE-070209-32
Description:
hypothetical protein LOC100009650 [Source:RefSeq peptide;Acc:NP_001076488]
Human Orthologues:
SLC27A2, SLC27A5
Human Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 [Source:HGNC Symbol;Acc:10996]
solute carrier family 27 (fatty acid transporter), member 5 [Source:HGNC Symbol;Acc:10999]
Mouse Orthologues:
Slc27a2, Slc27a5
Mouse Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347099]
solute carrier family 27 (fatty acid transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1347100]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39185 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097163 Nonsense 618 619 10 10
Genomic Location (Zv9):
Chromosome 18 (position 245135)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 60777
GRCz11 18 60777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCACCCTGACCCCCAACATCTACCAGCAGATCCTAGCGCACAGCATC[A/T]AACTCTGATTACTGCCTCATCAGCGATACTGTTAGAGAAACACAATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link