
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CCDC15
- Ensembl ID:
- ENSDARG00000067517
- Description:
- coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
- Human Orthologue:
- CCDC15
- Human Description:
- coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
- Mouse Orthologue:
- Ccdc15
- Mouse Description:
- coiled-coil domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:2444488]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10073 | Essential Splice Site | Available for shipment | Available now |
sa517 | Essential Splice Site | Available for shipment | Available now |
sa40572 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10073
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097160 | Essential Splice Site | 182 | 459 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 59896042)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 57759419 GRCz11 5 58429427 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTTATCGCAGCTACCTGGTGGGAGATGGAAAATATCTCYTGCTAGAAAT[G/A]TGAGTCATGCAWGATGCATTTGGGTCATTTTCAAGACSTGAACAGTCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa517
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097160 | Essential Splice Site | 286 | 459 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 59905587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 57768964 GRCz11 5 58438972 - KASP Assay ID:
- 554-0347.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGTTTTACCAAAACTATTGCCTTTTTCAATCATTAAGCATTTTGTTTC[A/T]GAGGCAGTCTCAGTTCCTTATGTATCGACGACACTTCATGGACATCGAGC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa40572
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097160 | Nonsense | 295 | 459 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 59905616)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 57768993 GRCz11 5 58439001 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCATTAAGCATTTTGTTTCAGAGGCAGTCTCAGTTCCTTATGTATCGA[C/T]GACACTTCATGGACATCGAGCGAGAGCAAGTGAAGGAGCACAAAAGGCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: