zgc:162175

Ensembl ID:
ENSDARG00000063882
ZFIN ID:
ZDB-GENE-070410-29
Description:
cytochrome c oxidase assembly protein COX19 [Source:RefSeq peptide;Acc:NP_001104010]
Human Orthologue:
COX19
Human Description:
COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28074]
Mouse Orthologue:
Cox19
Mouse Description:
COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915283]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37840 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093583 Nonsense 58 93 2 3
Genomic Location (Zv9):
Chromosome 24 (position 12650722)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12602459
GRCz11 24 12748753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAATCATTTTGACAACTCGCGATGTCGGATAGAATCAAAGGAGTA[T/A]CTGGAGTGCAGAATGGACAGGTGAGCTTTTTCTTCCCCCTAAGTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link