USP8

Ensembl ID:
ENSDARG00000063719
Description:
ubiquitin specific peptidase 8 [Source:HGNC Symbol;Acc:12631]
Human Orthologue:
USP8
Human Description:
ubiquitin specific peptidase 8 [Source:HGNC Symbol;Acc:12631]
Mouse Orthologue:
Usp8
Mouse Description:
ubiquitin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1934029]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43021 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093376 Nonsense 1077 1099 22 22
Genomic Location (Zv9):
Chromosome 18 (position 158826)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 106712
GRCz11 18 106712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACTGCAAGAACCCCATGAAGCAGCGCTGGTTCAAGTTTGACGATCAC[G/T]AGGTCTCCGAGATCTCCAGCTCCACGGTGCGCTCGCCCGCAGCTTACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link