si:dkeyp-1d11.1

Ensembl ID:
ENSDARG00000063706
ZFIN ID:
ZDB-GENE-091117-3
Human Orthologue:
PDE8B
Human Description:
phosphodiesterase 8B [Source:HGNC Symbol;Acc:8794]
Mouse Orthologue:
Pde8b
Mouse Description:
phosphodiesterase 8B Gene [Source:MGI Symbol;Acc:MGI:2443999]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17719 Essential Splice Site Available for shipment Available now
sa29518 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44956 Nonsense Mutation detected in F1 DNA During 2018
sa19254 Nonsense Mutation detected in F1 DNA During 2018
sa9848 Nonsense Available for shipment Available now
sa37233 Nonsense Mutation detected in F1 DNA During 2018
sa43583 Nonsense Mutation detected in F1 DNA During 2018
sa44955 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9852 Nonsense Available for shipment Available now
sa19253 Nonsense Mutation detected in F1 DNA During 2018
sa32333 Nonsense Available for shipment Available now
sa37232 Nonsense Mutation detected in F1 DNA During 2018
sa37231 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Essential Splice Site 272 874 7 22
ENSDART00000134519   None 500 None 12
ENSDART00000143409 Essential Splice Site 178 273 6 9
Genomic Location (Zv9):
Chromosome 21 (position 7618722)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7941189
GRCz11 21 7678857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGTCAGGAGGCCGTGGAGATCAGCAGTGAGGATCATGTCATACAAG[T/C]GAGTTCTRGGAGACAAACACRGTCTTCCTACTGGGATTTGCTTACATTRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Essential Splice Site 319 874 8 22
ENSDART00000134519   None 500 None 12
ENSDART00000143409 Essential Splice Site 225 273 7 9
Genomic Location (Zv9):
Chromosome 21 (position 7614997)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7937464
GRCz11 21 7675132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCCGACCTGCTGGACACCATCAACACCTGCATCAAGAAAGGAAAGG[T/G]CAGACGCCTATTCGAGCACCATAAAAGTATCTGCTTTAACCTTAATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 325 874 9 22
ENSDART00000134519   None 500 None 12
ENSDART00000143409 Nonsense 231 273 8 9
Genomic Location (Zv9):
Chromosome 21 (position 7614894)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7937361
GRCz11 21 7675029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATGTTCAACATGTGTGTTTGTTTGCCCAGGAATGGCAGGGGATCTA[T/A]TTCTCAAGGAGGAAGTCAGGGGACAGTATTCAGCAATATGTCAAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 383 874 11 22
ENSDART00000134519 Nonsense 9 500 1 12
ENSDART00000143409   None 273 None 9
ENSDART00000093339 Nonsense 383 874 11 22
ENSDART00000134519 Nonsense 9 500 1 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7605245)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7927712
GRCz11 21 7665380
KASP Assay ID:
2261-5224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTTCACAAGCTGAGCAAAGAAGAGAAATGCTGTGGTGAACACTCA[C/T]AATCAGGTACAGTAGCTGTCTTTGAAGCGTTGTTTGTTTACTATGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 383 874 11 22
ENSDART00000134519 Nonsense 9 500 1 12
ENSDART00000143409   None 273 None 9
ENSDART00000093339 Nonsense 383 874 11 22
ENSDART00000134519 Nonsense 9 500 1 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7605245)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7927712
GRCz11 21 7665380
KASP Assay ID:
2261-5224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGTTCACAAGCTGAGCAAAGAAGAGAAATGCTGTGGTGAACACTCA[C/T]AATCAGGTACAGTAGCTGTCYTTGAAGCGTTGTTTGTTTACTAWGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 415 874 13 22
ENSDART00000134519 Nonsense 41 500 3 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7602551)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7925018
GRCz11 21 7662686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGCTCCTAGTCTA[C/T]AGAACCGCAGATATTCCTCTATGGCCCGAATTCATTCGATGACGATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 419 874 13 22
ENSDART00000134519 Nonsense 45 500 3 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7602537)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7925004
GRCz11 21 7662672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCTCTCTCTCTCTCAGCTCCTAGTCTACAGAACCGCAGATA[T/A]TCCTCTATGGCCCGAATTCATTCGATGACGATTGAGGCTCCGATCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Essential Splice Site 436 874 13 22
ENSDART00000134519 Essential Splice Site 62 500 3 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7602484)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7924951
GRCz11 21 7662619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTATGGCCCGAATTCATTCGATGACGATTGAGGCTCCGATCACTAAGG[T/C]ACACCTGCATGCAAGAAATTCTGTCCATCACTAAACACACAGCAGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 495 874 15 22
ENSDART00000134519 Nonsense 121 500 5 12
ENSDART00000143409   None 273 None 9
ENSDART00000093339 Nonsense 495 874 15 22
ENSDART00000134519 Nonsense 121 500 5 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7597235)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7919702
GRCz11 21 7657370
KASP Assay ID:
2261-5223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACTCAGATTTACTGTTGTGTATTTCTTCTTCACTGCAGGACGGACTC[A/T]GAAGGCTCTCCGGGAACGAGTACRTCTTCTCCAAAAGTGCTTTACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 495 874 15 22
ENSDART00000134519 Nonsense 121 500 5 12
ENSDART00000143409   None 273 None 9
ENSDART00000093339 Nonsense 495 874 15 22
ENSDART00000134519 Nonsense 121 500 5 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7597235)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7919702
GRCz11 21 7657370
KASP Assay ID:
2261-5223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTCAGATTTACTGTTGTGTATTTCTTCTTCACTGCAGGACGGACTC[A/T]GAAGGCTCTCCGGGAACGAGTACATCTTCTCCAAAAGTGCTTTACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 588 874 17 22
ENSDART00000134519 Nonsense 214 500 7 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7593063)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7915530
GRCz11 21 7653198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTCTGAACTGCTCCGAGTCCACGCTGCGCTTGTGGCTGCAGGTGATC[G/T]AGACCAACTATCACTCCTCAAACTCCTACCATAACTCCACACACGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Nonsense 763 874 20 22
ENSDART00000134519 Nonsense 389 500 10 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7588417)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7910884
GRCz11 21 7648552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTCAGGCCAGTATTCGTAACTCTCCTGAGAATCGGCTACTGATTAAA[C/T]GAATGCTGATTAAATGTGCGGATGTGGCCAATCCCTGTCGACCGCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093339 Essential Splice Site 839 874 22 22
ENSDART00000134519 Essential Splice Site 465 500 12 12
ENSDART00000143409   None 273 None 9
Genomic Location (Zv9):
Chromosome 21 (position 7582378)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7904845
GRCz11 21 7642513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATCAAGTTTATTTTTTAGATTAATTTCTCTCTGTTTCTCTTTCTCA[G/A]CCTTTGCCAGTTTGCCAGGTCTGATGGAGCATTTGGCAGAGAACTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link