
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
FARP1 (2 of 2)
- Ensembl ID:
- ENSDARG00000063695
- Description:
- FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
- Human Orthologue:
- FARP1
- Human Description:
- FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
- Mouse Orthologue:
- Farp1
- Mouse Description:
- FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) Gene [Source:MGI Symbol;
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44699 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44699
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093306 | Nonsense | 36 | 314 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 1179652)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 1188806 GRCz11 9 988164 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGCGTGACGTTGTTCTCATCTCTGCTGTTGCTTTACTTTACAGGTCTG[G/A]CTGGATTTACTAAAGCCCATTAGAAAGCAGATCACACGTAAGACCACTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Brain structure: Voxelwise genome-wide association study (vGWAS). (View Study)
- Non-alcoholic fatty liver disease histology (other): Genome-wide association study identifies variants associated with histologic features of nonalcoholic Fatty liver disease. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)
- Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: