ppm1h

Ensembl ID:
ENSDARG00000063684
ZFIN ID:
ZDB-GENE-061027-190
Description:
Protein phosphatase 1H [Source:UniProtKB/Swiss-Prot;Acc:Q05AL2]
Human Orthologue:
PPM1H
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1H [Source:HGNC Symbol;Acc:18583]
Mouse Orthologue:
Ppm1h
Mouse Description:
protein phosphatase 1H (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2442087]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45016 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093277 Essential Splice Site 251 516 3 10
Genomic Location (Zv9):
Chromosome 25 (position 1663245)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1524052
GRCz11 25 1604697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGAGAGTCTGGTGGTGGGAGCCATAGAGAACGCATTCAAAGAGATGG[T/C]GAGGGGTTAACAAAGAGATGGGTCTGGAACTGTAGTAGCTCCTGTGGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link