si:dkey-263h23.7

Ensembl ID:
ENSDARG00000063682
ZFIN ID:
ZDB-GENE-060503-633
Description:
Novel protein similar to vertebrate formin homology 2 domain containing 3 (FHOD3) [Source:UniProtKB/
Human Orthologue:
FHOD3
Human Description:
formin homology 2 domain containing 3 [Source:HGNC Symbol;Acc:26178]
Mouse Orthologue:
Fhod3
Mouse Description:
formin homology 2 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1925847]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23403 Nonsense Available for shipment Available now
sa9923 Nonsense Available for shipment Available now
sa25077 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 303 1407 9 25
ENSDART00000146050 Nonsense 309 1323 9 24
Genomic Location (Zv9):
Chromosome 19 (position 719466)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 740953
GRCz11 19 740762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGATGTTCTTGAGGAGCAGGGCATGGAGAGCGTTTCTCAGCGGTA[T/G]CTGGGCCGCAAGGGCACCGATCTGGACCTGCTGGAGCAGCTCAACATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 1085 1407 20 25
ENSDART00000146050 Nonsense 1001 1323 19 24
Genomic Location (Zv9):
Chromosome 19 (position 740242)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 761729
GRCz11 19 761538
KASP Assay ID:
2261-2726.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTAGCTGATGCTGGTGTGTGCAGGCYAAGGGCTTCGATCTGAACTA[T/A]CTGGAGAAGGTTCCGGAGGTGAAGGACACGGTGCACAAACAGTCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 1205 1407 22 25
ENSDART00000146050 Nonsense 1121 1323 21 24
Genomic Location (Zv9):
Chromosome 19 (position 740817)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 762304
GRCz11 19 762113
KASP Assay ID:
554-7514.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGTTGATTGATGTTTCAGGTTCCACTCGTTCCTGCTGTTCCTGGGT[C/T]AGCCGGCGTACAGCGTGCGGGAGATCAGCGTGACGCGCTTCAGTAAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link