
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TULP3
- Ensembl ID:
- ENSDARG00000063672
- Description:
- tubby like protein 3 [Source:HGNC Symbol;Acc:12425]
- Human Orthologue:
- TULP3
- Human Description:
- tubby like protein 3 [Source:HGNC Symbol;Acc:12425]
- Mouse Orthologue:
- Tulp3
- Mouse Description:
- tubby-like protein 3 Gene [Source:MGI Symbol;Acc:MGI:1329045]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11948 | Essential Splice Site | Available for shipment | Available now |
sa18771 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11948
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093236 | Essential Splice Site | 19 | 510 | 1 | 12 |
ENSDART00000093236 | Essential Splice Site | 19 | 510 | 1 | 12 |
- Genomic Location (Zv9):
- Chromosome 4 (position 1342138)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 1634448 GRCz11 4 1483761 - KASP Assay ID:
- 2259-4307.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTGGAGGACGACAGCCTGAACCTCAGGCAGCAGAAACTGGAGAAACAG[G/A]TGAGACACWTATACGCACAACAAAATATTAANGAACACGTGCAAACAGTRA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18771
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093236 | Essential Splice Site | 19 | 510 | 1 | 12 |
ENSDART00000093236 | Essential Splice Site | 19 | 510 | 1 | 12 |
- Genomic Location (Zv9):
- Chromosome 4 (position 1342138)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 1634448 GRCz11 4 1483761 - KASP Assay ID:
- 2259-4307.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTGGAGGACGACAGCCTGAACCTCAGGCAGCAGAAACTGGAGAAACAG[G/A]TGAGACACATATACGCACAACAAAATATTAAGAACACGTGCAAACAGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: