zgc:154100

Ensembl ID:
ENSDARG00000063670
ZFIN ID:
ZDB-GENE-060929-28
Description:
TFIIA-alpha and beta-like factor [Source:RefSeq peptide;Acc:NP_001070039]
Human Orthologues:
GTF2A1L, STON1, STON1-GTF2A1L
Human Descriptions:
general transcription factor IIA, 1-like [Source:HGNC Symbol;Acc:30727]
STON1-GTF2A1L readthrough [Source:HGNC Symbol;Acc:30651]
stonin 1 [Source:HGNC Symbol;Acc:17003]
Mouse Orthologues:
Gtf2a1l, Ston1
Mouse Descriptions:
general transcription factor IIA, 1-like Gene [Source:MGI Symbol;Acc:MGI:1919078]
stonin 1 Gene [Source:MGI Symbol;Acc:MGI:1924307]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35385 Nonsense Mutation detected in F1 DNA During 2018
sa42103 Nonsense Mutation detected in F1 DNA During 2018
sa31899 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6280 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093222   None 376 None 9
ENSDART00000093247 Nonsense 182 917 1 13
Genomic Location (Zv9):
Chromosome 13 (position 99658)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 78489
GRCz11 13 42122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCCCACTGCTCCAGCACCGGCCCCATGAGGAGCAGGAGCTCTTCCTG[C/T]AGATCTGTGACCGCGTGTGGATGCGGCAGGACAGCAGTGGCACCGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093222   None 376 None 9
ENSDART00000093247 Nonsense 441 917 2 13
Genomic Location (Zv9):
Chromosome 13 (position 98759)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 77590
GRCz11 13 41223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGATGAGGGTGGAGTGTGAGGTGGAGGAGGCGGCGGCGTCCAGCACA[C/T]GAGTGCAGTCTGTGGGCATCCAGAGCGACATCCAGCCGCACAAACAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093222   None 376 None 9
ENSDART00000093247 Essential Splice Site 542 917 5 13
Genomic Location (Zv9):
Chromosome 13 (position 95543)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 74374
GRCz11 13 38007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGTTCCACCATGCATTGAAATCTGTGTGTAATGTTAGAACTTCTGCA[G/A]TGTTCTGCTCAGTGATCATGTCTCTGTCCTCTGCTTTTCTCTCAGTCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093222 Nonsense 339 376 8 9
ENSDART00000093247 Nonsense 880 917 12 13
Genomic Location (Zv9):
Chromosome 13 (position 92254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 71085
GRCz11 13 34718
KASP Assay ID:
554-5420.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACATCCCGGAGATMTTTGACAMGGAGAACGTCATCGTCTGMCAATA[T/A]GACAAGGTAAAGAAGCAGAACGGATCATCCTSTCAGTTTACAGCGWTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link