wtip

Ensembl ID:
ENSDARG00000063666
ZFIN ID:
ZDB-GENE-050419-261
Description:
Wilms tumor protein 1-interacting protein homolog [Source:UniProtKB/Swiss-Prot;Acc:A8DZE6]
Human Orthologue:
WTIP
Human Description:
Wilms tumor 1 interacting protein [Source:HGNC Symbol;Acc:20964]
Mouse Orthologue:
Wtip
Mouse Description:
WT1-interacting protein Gene [Source:MGI Symbol;Acc:MGI:2141920]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35608 Nonsense Available for shipment Available now
sa45502 Nonsense Mutation detected in F1 DNA During 2018
sa22391 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 393 648 1 8
Genomic Location (Zv9):
Chromosome 13 (position 52090604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 604212
GRCz11 18 493430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGAAGTCAACATTGGGTTTAACTACTGCAAGGCGGGCGCCGGGGGA[C/T]AGCGCTTCAAGCTGCCGTACCAGGTCACTCCATCTCGGGACAGCGGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 480 648 3 8
Genomic Location (Zv9):
Chromosome 13 (position 52053249)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 566857
GRCz11 18 456075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGTGTTTGTTTTTTCAGGACGGAGGCTACGAGGAAAGGCTTTCTA[T/A]AATGTTAATGGAAAAGTGTACTGTGAAGAAGACTTCCTGGTGAGTATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 523 648 5 8
Genomic Location (Zv9):
Chromosome 13 (position 52041033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 554641
GRCz11 18 443859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTTGTAGATCCTGCAGGCTCTGGGCAGGTCGTA[T/A]CACCCTGGTTGTTTCCGCTGTGTGATCTGCAAGGAGGGTCTGGACGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link