zgc:171784

Ensembl ID:
ENSDARG00000063649
ZFIN ID:
ZDB-GENE-071004-39
Description:
transcriptional enhancer factor TEF-5 [Source:RefSeq peptide;Acc:NP_001103194]
Human Orthologue:
TEAD3
Human Description:
TEA domain family member 3 [Source:HGNC Symbol;Acc:11716]
Mouse Orthologue:
Tead3
Mouse Description:
TEA domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:109241]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15971 Essential Splice Site Available for shipment Available now
sa33977 Nonsense Mutation detected in F1 DNA During 2018
sa20825 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093199 Essential Splice Site 42 402 None 13
ENSDART00000127519 Essential Splice Site 68 453 None 13
Genomic Location (Zv9):
Chromosome 6 (position 54580275)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54617009
GRCz11 6 54625117
KASP Assay ID:
2259-8215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGTGGTCGCCGCAAAATCATCCTGTCAGATGAGGGGAAGATGTACGG[T/C]AAGTGAGCTGAAGGGGAAGTTRTGATGCAGAGATGAGCACAAAATTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093199 Nonsense 337 402 12 13
ENSDART00000127519 Nonsense 388 453 12 13
Genomic Location (Zv9):
Chromosome 6 (position 54623992)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54660726
GRCz11 6 54668834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAGGAAAGTGTTTGTATCGCATCCATCGCTCTCCCATGTGCGAATA[C/A]ATGATCAACTTCATCCACAAGCTCAAGCACCTGCCGGAGAAATACATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093199 Nonsense 393 402 13 13
ENSDART00000127519 Nonsense 444 453 13 13
Genomic Location (Zv9):
Chromosome 6 (position 54626574)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54663308
GRCz11 6 54671416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTGTATAGCGTTTGTATTTGAAGTGTCGACGAGTGAACACGGGGCA[C/T]AATACCACGTCTATAGGCTCATCAAGGACTAGCAGCGCATCGGTCAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link