zgc:153395

Ensembl ID:
ENSDARG00000063614
ZFIN ID:
ZDB-GENE-060825-57
Description:
hypothetical protein LOC751709 [Source:RefSeq peptide;Acc:NP_001038886]
Human Orthologue:
SKOR2
Human Description:
SKI family transcriptional corepressor 2 [Source:HGNC Symbol;Acc:32695]
Mouse Orthologue:
Skor2
Mouse Description:
SKI family transcriptional corepressor 2 Gene [Source:MGI Symbol;Acc:MGI:3645984]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21684 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101289 Nonsense 150 255 2 3
ENSDART00000124640 Nonsense 150 740 1 7
ENSDART00000126643 Nonsense 150 255 1 2
Genomic Location (Zv9):
Chromosome 10 (position 14585103)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 14598410
GRCz11 10 14556529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAACTGCCAGACAACTTTGCGTTTGAAGTGATGCATGAATGTGCTTG[G/A]GGCTGCCGGGGAAGTTTCATCCCAGCACGTTACAACAGCTCCAGGGCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link