antxr1

Ensembl ID:
ENSDARG00000063612
ZFIN ID:
ZDB-GENE-090514-5
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35178 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35179 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093113 Essential Splice Site 286 552 11 18
Genomic Location (Zv9):
Chromosome 12 (position 3297418)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2684418
GRCz11 12 2719151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACACGTTCCTGCTGTGTCCTGCGCCTGTTATAGATGAAGTCGGAAA[G/A]TAAGCTTGCGTCTGCCATGCATTAGAGCCGTGTTTATGATCCCAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093113 Essential Splice Site 473 552 17 18
Genomic Location (Zv9):
Chromosome 12 (position 3306474)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2693474
GRCz11 12 2728207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTGGATATGATCAGGTTTCACTCATGAGGCCGCAGCCAGGAGATCAT[G/T]TGAGTATTTGGTTCTAGATTATTCCATTTTAGGGGGGGGGCACTGTGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link