wbscr22

Ensembl ID:
ENSDARG00000063596
ZFIN ID:
ZDB-GENE-070410-68
Description:
Williams Beuren syndrome chromosome region 22 protein [Source:RefSeq peptide;Acc:NP_001076348]
Human Orthologue:
WBSCR22
Human Description:
Williams Beuren syndrome chromosome region 22 [Source:HGNC Symbol;Acc:16405]
Mouse Orthologue:
Wbscr22
Mouse Description:
Williams Beuren syndrome chromosome region 22 Gene [Source:MGI Symbol;Acc:MGI:1913388]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35787 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa35787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093074 Missense 91 282 5 12
Genomic Location (Zv9):
Chromosome 15 (position 1753293)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1793178
GRCz11 15 1758087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTTTTTATTTATTTATCATGGCGTCGTTGTTTTTGTTCAGATGTG[G/A]CCTTGGAGCGAGAGGTGGAGGGAGATCTCCTGCTGGGCGATATGGGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link