si:dkey-229p15.2

Ensembl ID:
ENSDARG00000063594
ZFIN ID:
ZDB-GENE-081031-101
Human Orthologue:
HIPK1
Human Description:
homeodomain interacting protein kinase 1 [Source:HGNC Symbol;Acc:19006]
Mouse Orthologue:
Hipk1
Mouse Description:
homeodomain interacting protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1314873]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24388 Nonsense Available for shipment Available now
sa37769 Nonsense Mutation detected in F1 DNA During 2018
sa11661 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093061 Nonsense 213 1124 1 16
ENSDART00000134061 Nonsense 213 700 1 9
ENSDART00000142305   None 89 None 2
Genomic Location (Zv9):
Chromosome 23 (position 36953057)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36734867
GRCz11 23 36857328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTCCAACAGCTACGAGGTCCTGGAGTTCCTTGGCCGGGGAACTTTC[G/T]GACAGGTCGCCAAATGCTGGAAGCGGGGAACCAATGAGATCGTGGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093061 Nonsense 402 1124 3 16
ENSDART00000134061 Nonsense 402 700 3 9
ENSDART00000142305   None 89 None 2
Genomic Location (Zv9):
Chromosome 23 (position 36947597)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36729407
GRCz11 23 36851868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGGTCTCTGGGTTGTGTCATTGCTGAACTGTTCCTGGGCTGGCCTT[T/A]GTATCCAGGAGCTTCAGAATACGATCAGGTCAGTAATAAGATTTGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093061 Essential Splice Site 739 1124 10 16
ENSDART00000134061   None 700 None 9
ENSDART00000142305   None 89 None 2
Genomic Location (Zv9):
Chromosome 23 (position 36934001)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36715811
GRCz11 23 36838272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGCTGACCCTCAGCTCTCGCCATCTGGAGCAGAGTGCCACAATGCTGG[T/C]AAACCTGTGTCCTGCCAACCAGATAAACCTGTTTCTCTTTCTTTCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link