uba5

Ensembl ID:
ENSDARG00000063588
ZFIN ID:
ZDB-GENE-031112-2
Human Orthologue:
UBA5
Human Description:
ubiquitin-like modifier activating enzyme 5 [Source:HGNC Symbol;Acc:23230]
Mouse Orthologue:
Uba5
Mouse Description:
ubiquitin-like modifier activating enzyme 5 Gene [Source:MGI Symbol;Acc:MGI:1913913]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30045 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8521 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093046 Essential Splice Site 65 399 2 12
Genomic Location (Zv9):
Chromosome 24 (position 9490131)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9549015
GRCz11 24 9689401
KASP Assay ID:
2261-8447.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTCGTCTAATGGCACTTAAGAGAATGGGGATAGTGCAAGACTACGAG[G/A]TAAACATGCTTGTCTGTTATTTTACGAGACTTTACCAGTGTTAAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093046 Nonsense 282 399 9 12
Genomic Location (Zv9):
Chromosome 24 (position 9479261)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9538145
GRCz11 24 9678531
KASP Assay ID:
2261-8446.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTAGGTATCTGTTGGGCTTCGGGACGGTGAGTTWTTACTTGGGCTA[T/A]AATGCCATGCAGGACTWCTTCCCAAGCATGGCAATGAARGCCAACCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link