
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch1073-219n12.1
- Ensembl ID:
- ENSDARG00000063580
- ZFIN ID:
- ZDB-GENE-091204-412
- Human Orthologues:
- PPP1R9A, SAMD14
- Human Descriptions:
- protein phosphatase 1, regulatory (inhibitor) subunit 9A [Source:HGNC Symbol;Acc:14946]
- sterile alpha motif domain containing 14 [Source:HGNC Symbol;Acc:27312]
- Mouse Orthologues:
- Ppp1r9a, Ppp1r9b, Samd14
- Mouse Descriptions:
- protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]
- protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]
- sterile alpha motif domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:2384945]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa733 | Nonsense | Available for shipment | Available now |
sa38721 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34545 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa733
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093021 | Nonsense | 252 | 1317 | 1 | 18 |
ENSDART00000139476 | None | 145 | None | 3 | |
ENSDART00000146148 | None | 308 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 9 (position 3054949)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 3050421 GRCz11 9 3056441 - KASP Assay ID:
- 554-0640.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGGTGGTGATGATAAAGAGTCAACRCAAGTAATCCCTGAGAAATCGAGC[A/T]GACCTATACAGGYAAGTTTCCAAAAAACAAGCTCACCTGCAACTGATTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38721
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093021 | Nonsense | 784 | 1317 | 7 | 18 |
ENSDART00000139476 | None | 145 | None | 3 | |
ENSDART00000146148 | Nonsense | 231 | 308 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 9 (position 3098732)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 3094204 GRCz11 9 3100224 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTCCAGATAAAGCACACCATCGCAGAAGCTGAAGTGGATGAGCTGAAA[G/T]AGAGAGTATGAACCTGTAAACCATTTACATTTGAAATCAGAATCATTAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34545
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093021 | Nonsense | 893 | 1317 | 9 | 18 |
ENSDART00000139476 | None | 145 | None | 3 | |
ENSDART00000146148 | None | 308 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 9 (position 3104539)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 3100011 GRCz11 9 3106031 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTGGATGAAAGAGAGAGCGCATATAAGAGTCAGATCGAGGATCTGCAG[C/T]GAAGGGTGAGAACTCACATCATACAGACAAAATCACTCGCACATAAAGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: