slc25a15a

Ensembl ID:
ENSDARG00000063539
ZFIN ID:
ZDB-GENE-070112-1072
Description:
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15a [Source:RefSeq p
Human Orthologues:
SLC25A15, SLC25A2
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 [Source:HGNC Symbo
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 [Source:HGNC Symbol
Mouse Orthologues:
Slc25a15, Slc25a2
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 Gene [Source:MGI S
solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 Gene [Source:MGI Sy

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39026 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9698 Essential Splice Site Available for shipment Available now
sa35791 Nonsense Mutation detected in F1 DNA During 2018
sa42472 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092942 Essential Splice Site None 303 1 7
Genomic Location (Zv9):
Chromosome 15 (position 3391307)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3294567
GRCz11 15 3282073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATACAGTGTGAAGAACAGAAGAAGTGTCCGGGAGCAGGACAGGGCGGG[T/C]GAGTTTGAAATTACTCGAACGTCAGATTGAGTTTAGTGTTGCTGAGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092942 Essential Splice Site 152 303 4 7
Genomic Location (Zv9):
Chromosome 15 (position 3373771)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3277029
GRCz11 15 3264545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGCATGAAATGGAGGCATCCGGCAAGATCGCCAGCGGACAAAAAAG[G/T]TCAGTTTGGACTGAGGACAGTTTGGTAGTCAATAAAAAACATGAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092942 Nonsense 190 303 5 7
Genomic Location (Zv9):
Chromosome 15 (position 3370076)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3273334
GRCz11 15 3260850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCACCACCACTATTGTCCGAGAGCTGCCTGGATATTTCTGTTTCTTT[G/T]GAGGTTATGAACTCAGCCGCTCCATATTTGCCCACCACATGGCCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092942 Nonsense 260 303 6 7
Genomic Location (Zv9):
Chromosome 15 (position 3368049)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3271307
GRCz11 15 3258823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTAGCAGGGAAACAGGAAGGTTTCATCAAGACTCTTATGGGGATTT[T/A]ACGAAACGAAGGTGAGAGTTTTGATTTCAAGATCTGAGGCACCCAGGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link