atm

Ensembl ID:
ENSDARG00000063465
ZFIN ID:
ZDB-GENE-040809-1
Description:
Ataxia telangiectasia mutated [Source:UniProtKB/TrEMBL;Acc:B6V8N0]
Human Orthologue:
ATM
Human Description:
ataxia telangiectasia mutated [Source:HGNC Symbol;Acc:795]
Mouse Orthologue:
Atm
Mouse Description:
ataxia telangiectasia mutated homolog (human) Gene [Source:MGI Symbol;Acc:MGI:107202]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28405 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128490 Nonsense 64 640 3 11
Genomic Location (Zv9):
Chromosome 15 (position 6553592)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6648039
GRCz11 15 6645362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAGTGTGCTCGGATGCTTATAAATAAGGATTCTTGCATACAGTTTTT[T/A]ACAGAAATTTCTTAAAAAAGAGACTGAACTTCTGCAGTCAGGAAAAGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link