wash

Ensembl ID:
ENSDARG00000063457
ZFIN ID:
ZDB-GENE-050419-138
Description:
WAS protein family homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:A4IG59]
Human Orthologues:
AC215219.1, WASH1, WASH4P, WASH6P
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MZE2]
WAS protein family homolog 1 [Source:HGNC Symbol;Acc:24361]
WAS protein family homolog 4 pseudogene [Source:HGNC Symbol;Acc:14126]
WAS protein family homolog 6 pseudogene [Source:HGNC Symbol;Acc:31685]
Mouse Orthologue:
ORF19
Mouse Description:
open reading frame 19 Gene [Source:MGI Symbol;Acc:MGI:1916017]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43035 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092752 Essential Splice Site 137 481 5 11
ENSDART00000136333 Essential Splice Site 134 448 4 10
Genomic Location (Zv9):
Chromosome 18 (position 5574454)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6348244
GRCz11 18 6488609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTTGATTACAGTACAGCTTCTCGTGTTGATTCCATCTTCTTATTCAT[A/G]GGAGAAGTTGATGTATTTGCCGGTGTGTGTGAACACTAAGAAGCGCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link