zgc:153222

Ensembl ID:
ENSDARG00000063445
ZFIN ID:
ZDB-GENE-060825-140
Description:
Synaptosomal-associated protein 47 [Source:UniProtKB/Swiss-Prot;Acc:Q0P4A7]
Human Orthologue:
SNAP47
Human Description:
synaptosomal-associated protein, 47kDa [Source:HGNC Symbol;Acc:30669]
Mouse Orthologue:
Snap47
Mouse Description:
synaptosomal-associated protein, 47 Gene [Source:MGI Symbol;Acc:MGI:1915076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19659 Essential Splice Site Available for shipment Available now
sa39749 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092741 Essential Splice Site None 419 None 6
ENSDART00000125425   None 419 None 4
ENSDART00000137842 Essential Splice Site None 371 None 4
ENSDART00000144332   None 34 None 2

The following transcripts of ENSDARG00000063445 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 3897044)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3571570
GRCz11 2 3402749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACCTTGCTGTAGCTGCCACTTTCAATTCTGAAGACATCCTAAAAGG[T/A]ATGAAATATTTCATTTCTGTGGAGGTTATTTCTGTACTTGAGCTGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092741 Nonsense 351 419 4 6
ENSDART00000125425 Nonsense 351 419 3 4
ENSDART00000137842 Nonsense 351 371 4 4
ENSDART00000144332   None 34 None 2

The following transcripts of ENSDARG00000063445 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 3889307)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3563833
GRCz11 2 3395012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCCAGGACACAGAGGTGCCAGTGGAGGTGCCTGCTGGAGAACTGACG[C/T]AACTGCAGCTTCAGGTGCTTCAGCCCACTGTTACTGAGGCGGAGGCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link