srebf2

Ensembl ID:
ENSDARG00000063438
ZFIN ID:
ZDB-GENE-070410-8
Description:
Sterol regulatory element-binding protein 2Processed sterol regulatory element-binding protein 2 [So
Human Orthologue:
SREBF2
Human Description:
sterol regulatory element binding transcription factor 2 [Source:HGNC Symbol;Acc:11290]
Mouse Orthologue:
Srebf2
Mouse Description:
sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44553 Nonsense Mutation detected in F1 DNA During 2018
sa19922 Essential Splice Site Available for shipment Available now
sa6024 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa31309 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092690 Nonsense 16 1095 1 20
Genomic Location (Zv9):
Chromosome 3 (position 1880434)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1338646
GRCz11 3 1107295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACATGGACGCCTCGGAGTTTATGGAGACCATGGACCCGAGTCTGTCC[G/T]AACTGGGCGACGAGTTCACCCTCGGAGACATCGACGGTAATAGCAACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092690 Essential Splice Site 158 1095 3 20
Genomic Location (Zv9):
Chromosome 3 (position 1888635)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1346847
GRCz11 3 1115496
KASP Assay ID:
554-6329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCAGAACCAGGTCATCTGCCAGCAGAACAATGCTACTAGCTTCCAGG[G/A]TGAGAAACACACCCACACACACACACACACACATCACACACATACTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092690 Splice Site, Nonsense 439 1095 8 20
Genomic Location (Zv9):
Chromosome 3 (position 1891640)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1349852
GRCz11 3 1118501
KASP Assay ID:
554-3918.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCTACTGCATCGACTCTGAGCCRGGGAGCCCACTGCTGGAGCATGAG[C/T]AGGTACACACACACACACACACACACACACACACNNNNNNNNNNNCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092690 Essential Splice Site 795 1095 14 20
Genomic Location (Zv9):
Chromosome 3 (position 1897026)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1355238
GRCz11 3 1123887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAGCCACGCACACACTGATAGAGCCGCAGAGCAGAGAGGATGCTGG[G/T]TAATCATTCACACTCACACACTCATCTGGATGATTTCTAGCCCTGTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link