
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
AP3B2
- Ensembl ID:
- ENSDARG00000063432
- Description:
- adaptor-related protein complex 3, beta 2 subunit [Source:HGNC Symbol;Acc:567]
- Human Orthologue:
- AP3B2
- Human Description:
- adaptor-related protein complex 3, beta 2 subunit [Source:HGNC Symbol;Acc:567]
- Mouse Orthologue:
- Ap3b2
- Mouse Description:
- adaptor-related protein complex 3, beta 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1100869]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30196 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37995 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa10266 | Nonsense | Available for shipment | Available now |
sa32510 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa30196
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092663 | Nonsense | 361 | 1102 | 10 | 26 |
- Genomic Location (Zv9):
- Chromosome 25 (position 6188719)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 5599270 GRCz11 25 5725786 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTGTTTGAATATGCAGCGTTTTGTCTTGTAGGGAATGTTTGAGCCGTA[T/A]CTGAAGAGTTTTTATATCCGCTCCACCGACCCGACGCAGATCAAAATTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37995
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092663 | Nonsense | 465 | 1102 | 13 | 26 |
- Genomic Location (Zv9):
- Chromosome 25 (position 6192278)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 5595711 GRCz11 25 5722227 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCTGAATCAGTGGTGGTGATCAAAAAGCTTCTCCAGATGCAGCCCGAG[C/T]AGCACAGTGACATCATCAAACACATGGCCAAACTCATCGACAACATTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10266
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092663 | Nonsense | 839 | 1102 | 21 | 26 |
- Genomic Location (Zv9):
- Chromosome 25 (position 6206706)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 5581283 GRCz11 25 5709204 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAATATAAACATGTATCATCTRTGTTTCTCAGTTGAACCGGCTCCAGCAT[C/A]GGCTCCGGTGACTCCAGTTAACTTCCTTTCCAGTAGTCTGGTGTCTGATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32510
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092663 | Essential Splice Site | 946 | 1102 | 23 | 26 |
- Genomic Location (Zv9):
- Chromosome 25 (position 6209371)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 5578618 GRCz11 25 5706955 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAGGCGCTTTTCTGTGACTTTATTTTTGTACCGTCTGCATTGTTCTTTC[A/T]GAGGTGTTAGCGGCGAATGAATCGGTTACCGTGGTGATGGGAATAGATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lipoprotein-associated phospholipase A2 activity change in response to statin therapy: Genome-wide association study evaluating lipoprotein-associated phospholipase A2 mass and activity at baseline and after rosuvastatin therapy. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: