zgc:175137

Ensembl ID:
ENSDARG00000063420
ZFIN ID:
ZDB-GENE-080220-49
Description:
epidermal Langerhans cell protein-like [Source:RefSeq peptide;Acc:NP_001121758]
Human Orthologue:
TOX4
Human Description:
TOX high mobility group box family member 4 [Source:HGNC Symbol;Acc:20161]
Mouse Orthologue:
Tox4
Mouse Description:
TOX high mobility group box family member 4 Gene [Source:MGI Symbol;Acc:MGI:1915389]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44437 Nonsense Mutation detected in F1 DNA During 2018
sa24821 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092701 Nonsense 2 537 1 8
Genomic Location (Zv9):
Chromosome Zv9_NA972 (position 15962)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1394051
GRCz11 7 1530131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAATACTGAAAGGTGGAGAGAATAAAGCTGTGATTCCGCGGAGTATG[G/T]AGGTAAGAGGACGCAGATCACTGTGTGTGTTTGTAGAGCTCGATAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092701 Nonsense 180 537 4 8
Genomic Location (Zv9):
Chromosome Zv9_NA972 (position 7250)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1402763
GRCz11 7 1538843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCAATCTGGGGGGTGGAGCCATCCTGCCCCATTCACAGTCTCCCGAA[C/T]AATCGATGTCAGCCACCGGCTCGCCATCTGATTCGCTACACGATGATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link