zgc:158828

Ensembl ID:
ENSDARG00000063419
ZFIN ID:
ZDB-GENE-070410-11
Description:
LOC100004107 protein [Source:UniProtKB/TrEMBL;Acc:Q1ECW4]
Human Orthologue:
DHX35
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 35 [Source:HGNC Symbol;Acc:15861]
Mouse Orthologue:
Dhx35
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 35 Gene [Source:MGI Symbol;Acc:MGI:1918965]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43908 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092679 Essential Splice Site 471 543 13 16
Genomic Location (Zv9):
Chromosome 23 (position 2941958)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2985011
GRCz11 23 2928461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTTTTTTGCTAACGCGGCCCGCATGCATCACTCCGGCTCCTACAGG[T/G]TGTTTTCTCTATCAGTTATTCCTCTTATCAATGTGATTTATCAATGTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Dialysis-related mortality: Genome-wide association scan for survival on dialysis in African-Americans with type 2 diabetes. (View Study)
  • Telomere length: A genome-wide association study identifies a locus on chromosome 14q21 as a predictor of leukocyte telomere length and as a marker of susceptibility for bladder cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link